Strona główna > medycyna, nauka, woo > „Wrogowie rozumu”

„Wrogowie rozumu”

Sierpień 16, 2007 Dodaj komentarz Go to comments

Na GoogleVideoo już można obejrzeć nowy film Richarda Dawkinsa pt. „Wrogowie rozumu” (a właściwie jego pierwszą część – druga ma zostać wyświetlona w przyszłym tygodniu obie części). Tym razem Dawkins wojuje z woo – astrologią, uzdrawiaczami aktywującymi 12 nici DNA, homeopatią, itp.

O filmie można poczytać po polsku i po angielsku. Oba artykuły wspominają o fragmencie, który w ostatecznej wersji filmu ponoć się nie pojawia. Jedna z napotkanych na targach New Age wróżek długo opowiadała Dawkinsowi o tym, że jest w kontakcie z duchem jego zmarłego ojca. Twierdziła, że duch jest smutny, ponieważ nie mieli okazji się pożegnać, chciałby, żeby go częściej wspominać. Kiedy Dawkins odparł, że jego ojciec żyje i ma się dobrze, wróżka przerwała wywiad i zabroniła jego wykorzystania.

Edit – z podziękowaniem dla Łukasza:

Część druga też jest już dostępna.

Kategorie:medycyna, nauka, woo Tags:
  1. sz
    Sierpień 17, 2007 o 12:33 am

    fajny gość ale efekt jego wysiłków jest i może być tylko taki, że garstka „wykształciuchów” oglądając te filmy cieszy się z przynależności do elity. no niby dobrze jest znać diagnozę choroby ale przecież znamy ją od dawna…
    krótko mówiąc: że też mu się chce!

  2. KingKong
    Sierpień 17, 2007 o 4:12 pm

    moim zdaniem Dawkins może imponować małoletynim ludziom, którzy nie mając jeszcze ukształtowanego charakteru szukają wzorca do naśladowania wśród wielkich tego świata (muzyków rockowych, sj. techno i wojujących aktorach, znaczy ateistach). Z tego co widze, to poza biologicznym przesłaniem Twoja strona nie stroni od ideologicznego. Czy nauka ma Ci służyć do dowodzenia prawdy,czy ma być używana do walki z religią? Zastanów się na tym głęboko, ponieważ jeśli ma służyć do dowodzenia prawdy, to po co ten materiał mieszać z ideologiczną miernotą w wydaniu Dawkinsa? Brakuje czysto naukowych argumentów popierających TE ,że aż trzeba sięgac do takich metod, co by ją uwiarygidnić?
    Szarlatanów i pośród naukowców nie brakuje. Jeśli idzie o religie ,to Biblia wyraznie oddziela czyste wielbienie Prawdziwego Boga od nieczystego wróżbiarstwa i astrologii. Myślę,że jak chce się kogoś krytykować, to nalezy zapoznać się z jego poglądami.

    pozdrawiam.

  3. Sierpień 17, 2007 o 11:10 pm

    Hahaha… Świetny fragment z tą wróżką😀

  4. Sierpień 18, 2007 o 11:37 am

    > moim zdaniem Dawkins może imponować małoletynim ludziom, którzy nie mając jeszcze ukształtowanego charakteru
    > szukają wzorca do naśladowania

    Aha…i czym Dawkins w tym wypadku różni się od Jana Pawła II wraz z jego naśladowcami szukającymi Wzorca ?😛

    Religia jest wrogiem Rozumu i Nauki. Jest ponieważ wypowiedziała Nauce wojnę. A Dawkins jest Św. Pawłem rozsądku.

  5. Sierpień 18, 2007 o 10:42 pm

    Uprzejmie zapraszam do zapoznania sie z fragmentami napisanej przeze mnie drugiej części orwellowskiej Animal Farm.

    http://wierszole2007.wordpress.com/2007/08/18/animal-farm-ii-przedmowa/

  6. Sierpień 19, 2007 o 5:17 am

    @KingKong: Dawkins tym razem nie zwalcza religii ale ewidentne bzdury. Nie rozumiem czemu poinformowanie o tym miało by być zajmowaniem pozycji ideologicznej, a szczególnie walczącej z jakąkolwiek religią. Tego w tekście „Wrogowie rozumu” nie potrafię wyczytać. „Wojujący aktorzy, znaczy ateiści” też chyba należą do jakiejś innej rozmowy, nieprawda?

    Aha, teraz oczy mi się kleją, ale jak się odkleją spróbuję napisać (u mnie) czemu odrzucam wiele jego argumentów nie potrzebując przylepiać Dawkinsowi etykietki „ideologicznej miernoty”. A miernoty (np. parę ideoblogów PRL-u czy Salonu24) omijam, bo głupota może być zakaźna.

  7. KingKong
    Sierpień 19, 2007 o 2:43 pm

    >Aha…i czym Dawkins w tym wypadku różni się od Jana Pawła II >wraz z jego naśladowcami szukającymi Wzorca ?

    Niczym.

    >Religia jest wrogiem Rozumu i Nauki. Jest ponieważ >wypowiedziała Nauce wojnę. A Dawkins jest Św. Pawłem

    A to dlaczego religia jest wrogiem nauki? Przeciez nauka potwierdza prawdziwośc ID, wbrew zapewnieniom takiej zindoktrynowanej i biednej miggaweczki:)

    A jęśli religia jest wrogiem rozumu, to co powiesz o kwantowo-teologicznych,naukowych rozważaniach o tym co było przed Wielkim Wybuchem? Czy to, co było przed Wielkim Wybuchem mieści się w twojej głowie?
    Jeśli coś się w głowie nie mieści, to może lepiej uznać,że głowa zaciasna, co?:)

    pozdrawiam.
    http://forum.gazeta.pl/forum/71,1.html?f=32

  8. KingKong
    Sierpień 19, 2007 o 4:00 pm

    „Logika” „naukowca” Dawkinsa.

    Dawkins w swojej książce „Rzeka genów” Puszczając wodze wyobrazni pisze:
    Bohaterem jego opowiadania jest fikcyjny profesor, który uwieziony przez wrogie mocarstwo jest zmuszany do pracy nad bronią masowej zagłady. Postanawia ostrzec ludzi i drogą inżynierii genetycznej zapisuje w DNA wirusa grypy ostrzeżenie dla ludzkości. Pózniej kicha na naradzie naukowej ,dalej ktoś zarażony w porcie lotniczym i tak świat zaraża sie ostrzeżeniem o niebezpieczeństwie.

    Dawkins pisze,że ilość trypletów pozwala na określenie liter alfabetu angielskiego, z uwzględnieniem wielkich liter i znaku kropki.

    Naukowcy zaczynają badać nowy szczep wirusa i dostrzegają osobliwy (nie mogący kodować żadnego ze znanych białek w wirusie grypy) ciąg DNA.
    I TUTAJ UWAGA: Dawkins pisze:

    „ktoś zauważa sekwencję złożoną z następujących po sobie cyfr KTÓRY W ŻADEN SPOSÓB NIE MÓGŁ POWSTAĆ SPONTANICZNIE, BEZ INGERENCJI CZŁOWIEKA”

    Człowieka czyli inteligencji!
    Nie przeszkadza to jednak Dawkinsowi przyjąć bez zmrużenia oka ,że niezwykle skomplikowane sekwencje w DNA ,które umożliwiaja zakodowanie poplipeptydów, takich jak enzymy, które z reguły składaja sie ze 100 aminokwasów tj. 300 nukleotydów w ściśle uporządkowanej sekwencji powstały spontanicznie:)

    Ciekawe jak Dawkins odróżnia działalność inteligenta od działalności inteligentnej? I jedną przypisuje inteligencji,a drugą (bardziej inteligentną) ślepym siłom natury?:)Przeciez rozszyfrowaliśmy kod genetyczny i widzimy wyraznie logike ,jaka on niesie,więc dlaczego ślepy Dawkins przypisuje ją przypadkowi?
    A jakie jest tego prawdopodobieństwo, o tym pisał już Hoyle i nic dziwnego,że Dawkins produkował sie i innej swojej książce żeby obalić rozumowanie Hoyla (wyglądało to komicznie, poniewaz z jednej strony znamionowała Dawkinsa impotencja intelektualna,a z drugiej strony nie wypadało mu-z braku argumentów zmieszac z błotem szlachcica i uczonego tej miary co Fred Hoyle).

    Dzisiaj już nie tylko biochemia http://forum.gazeta.pl/forum/72,2.html?f=32&w=65989882 ,ale już od dawna matematyka stoi przeciwko tezie o samorzutnym pojawieniu się zycia. A więc ta koncepcja jest PRZEGRANA,a z nią cała hipoteza neodarwinowska:

    Jakie jest prawdopodobieństwo połączenia się odpowiednich aminokwasów w cząsteczkę białka prostego? Wyobraźmy sobie duży kopiec nasion czerwonej i białej fasoli. Oba rodzaje są w równych ilościach i starannie wymieszane. Poza tym należą one do ponad 100 różnych odmian fasoli. Co by się nabrało na szufelkę zanurzoną w tym kopcu? Gdyby chcieć naczerpać tylko tych nasion, które wyobrażają podstawowe składniki protein, to na szufelce musiałyby się znaleźć same czerwone — ani jednego białego! Co więcej, na szufelce musiałoby być 20 odmian nasion czerwonej fasoli, i do tego każde z nich na ściśle określonym miejscu. Gdyby — przenosząc to na grunt protein — choćby jeden z tych warunków nie został spełniony, odbiłoby się to ujemnie na prawidłowym funkcjonowaniu danej proteiny. Czy mieszanie do woli w tym hipotetycznym kopcu i nabieranie na szufelkę, pozwoliłoby kiedykolwiek uzyskać właściwą kombinację? Nie. Dlaczego więc miałoby się to udać w hipotetycznym bulionie pierwotnym?

    Proteiny niezbędne do powstania życia są złożone z bardzo skomplikowanych cząsteczek. Jakie jest prawdopodobieństwo przypadkowego powstania nawet całkiem prostej cząsteczki białka w bulionie pierwotnym? Ewolucjoniści przyznają, że prawdopodobieństwo to wynosi 1 do 10113 (jedynka ze 113 zerami). Tymczasem matematycy uważają, że już zdarzenie, którego prawdopodobieństwo wyraża się liczbą 1 do 1050, nigdy nie nastąpi. Pewne pojęcie o możliwości czy prawdopodobieństwie takiego zdarzenia pozwala wyrobić sobie fakt, że liczba 10113 jest większa od szacunkowej liczby wszystkich atomów we wszechświecie!

    [19] Jedne proteiny służą za budulec, a drugie za enzymy. Te ostatnie przyspieszają konieczne reakcje chemiczne w komórce, która bez nich by zginęła, a do jej funkcjonowania potrzeba nie kilku, lecz 2000 protein służących za enzymy. Jakie jest prawdopodobieństwo przypadkowego powstania tych protein? Wynosi ono 1 do 1040 000! „Jest to prawdopodobieństwo tak krańcowo małe” — przyznaje Hoyle — „że takie zdarzenie byłoby nie do pomyślenia nawet wówczas, gdyby cały wszechświat składał się tylko z bulionu pierwotnego”. Następnie dodaje: „Choćby nawet czyjeś przekonanie lub wykształcenie pozwalało mu bez uprzedzeń przychylić się do poglądu, że życie powstało na Ziemi [samorzutnie], to ten prosty rachunek całkowicie przekreśla taką koncepcję”.

    [20] Jednakże takie prawdopodobieństwo jest w rzeczywistości jeszcze znacznie mniejsze, niż by to wynikało z owej „krańcowo małej” liczby. Komórka musi być otoczona błoną. Ta błona jest jednak niezwykle złożona, składa się bowiem z cząsteczek białek prostych, cukrów i tłuszczów. Ewolucjonista Leslie Orgel pisze: „Obecnie w błonach komórkowych są kanały i pompy, które w określony sposób sterują dopływem i odpływem składników odżywczych, produktów przemiany materii, jonów metali itd. W tych wyspecjalizowanych kanałach znajdują się specyficzne proteiny, to znaczy cząsteczki, których nie mogło tam być na samym początku ewolucji życia”

    pzdr.

  9. KingKong
    Sierpień 19, 2007 o 4:39 pm

    …Sile mojej argumentacji dodaje fakt, iż Dawkins przyznał w swojej książce „Ślepy zegarmistrz”,że maszyneria transkrypcyjno-translacyjna ma wszelkie cechy układu inteligentnie zaprojektowanego. Oczywiście zaznaczył,iż przyjęcie naturalnego wniosku o inteligentnym zaprojektowaniu takiej maszynerii stoi w sprzeczności ze światopoglądem naukowym, którego przeświadczeniem jest ,iż ta skąplikowana maszyneria transkrypcyjno-translacyjna, która ma wszelkie cechy układu zaprojektowanego przez inteligencje, musiała jakoś powstac sama:).

    pozdrawiam.

  10. klaudiusz
    Sierpień 19, 2007 o 4:47 pm

    Drogi Panie lub Pani KingKong,”Myślę,że jak chce się kogoś krytykować, to należy zapoznać się z jego poglądami”, bardzo mądre słowa, ciekawe kto je Panu lub Pani podpowiedział.
    Film, do obejrzenia którego zachęca gospodyni tego bloga, (moim nieskromnym zdaniem dość nudny, film, nie blog), nie zawiera żadnych treści krytykujących kreacjonizm, negujących istnienie Boga oraz nie odnosi się do jakiejkolwiek religii, traktującej Biblię jako źródło prawdy.
    Treścią filmu jest „biznes magiczny”. Dawkins, próbując w tym filmie ośmieszyć takie praktyki, nie działa wbrew Biblii („Jeśli idzie o religie ,to Biblia wyraznie oddziela czyste wielbienie Prawdziwego Boga od nieczystego wróżbiarstwa i astrologii.”) skąd w takim razie napastliwe i niegrzeczne posty skierowane przez Pana lub Panią do Miggawki? Dlaczego pojawia się sugestia, że nauka ma jej służyć do walki z religią? Notabene, jeśli wierzyć wordpressowej wyszukiwarce Dawkins pojawia się na tym blogu po raz pierwszy i, zdecydowanie, nie w kontekście teorii ewolucji. Jak mogła zatem Pani/Panu przyjść do głowy myśl, że notka ta ma coś wspólnego „z obroną teorii ewolucji przy braku naukowych argumentów”?
    Przy okazji, czy mógłbym prosić o przedstawienie kwantowo-teologicznych,naukowych rozważań o tym co było przed Wielkim Wybuchem, w przystępnej dla mojego bardzo ciasnego umysłu formie, najlepiej przeglądówki opierającej się na publikacjach w czasopismach z listy filadelfijskiej („naukowych rozważań”)?
    pozdrawiam
    klaudiusz,co to przyjacielem Darwina jest, Dawkinsa raczej nie, i wierzy w to, co napisane jest w Biblii

  11. KingKong
    Sierpień 19, 2007 o 5:59 pm

    >Film, do obejrzenia którego zachęca gospodyni tego bloga, (moim

    >nieskromnym zdaniem dość nudny, film, nie blog), nie zawiera

    >żadnych treści krytykujących kreacjonizm, negujących istnienie

    >Boga oraz nie odnosi się do jakiejkolwiek religii, traktującej

    >Biblię jako źródło prawdy…

    Tylko,że Pan KingKong nie krytykował Dawkinsa za ten tylko film,lecz za całość pseudoteologicznej twórczości, której owy jest tylko elementem. Każdy doinformowany wie,że dla Dawkinsa przekaz biblijny,astrologia, różdzkarstwo,jasnowidzenie maja identyczny status pseudonaukowy.
    Zdaje sobie też sprawę z owego faktu autorka tego bloga, ponieważ owy wątek stanowi tylko następny element jej zacietrzewionej i nie uzasadnionej krytyki Inteligentnego Projektu. Blog na którym pozwolono nam dyskutować (ciekawe jak długo, ponieważ kneblowanie kreacjonistów poprzez banowanie to reguła u ewolucjonistów/ateistów) jest bardzo ciekawy dopóki doputy z materiału ,który sie tu prezentuje nie wyciąga sie nieuzasadnionych wniosków charakteru ideologicznego.

    pozdrawiam.

  12. KingKong
    Sierpień 19, 2007 o 6:05 pm

    >Przy okazji, czy mógłbym prosić o przedstawienie
    >kwantowo-teologicznych,naukowych rozważań o tym co było przed
    >Wielkim Wybuchem, w przystępnej dla mojego bardzo ciasnego umysłu >formie, najlepiej przeglądówki opierającej się na publikacjach w >czasopismach z listy filadelfijskiej (”naukowych rozważań”)?

    Ja też bym był rad zobaczyć taką przeglądówkę. Póki co w „okresie” przed wielkim Wybuchem ukrywa sie przegrana ateistów:)

    >klaudiusz,co to przyjacielem Darwina jest, Dawkinsa raczej nie, i >wierzy w to, co napisane jest w Biblii.

    Jak Pan to robi,jak to możliwe?

    pozdrawiam.

  13. klaudiusz
    Sierpień 19, 2007 o 9:33 pm

    W pierwszych dwóch komentarzach Pan KingKong krytykował nie tylko Dawkinsa, ale i Miggawkę, i, w dodatku, sugerował brak posiadania przez miggmigg argumentów popierających TE (teorię ewolucji?) oraz wykorzystywanie bloga do walki z religią, tylko dlatego, że podała informację o filmie poświeconym woo. Może to jednak Pan ma tendencję do wrzucania religii, astrologii, chiromancji, horoskopów oraz wszystkich innych spraw czarowników do jednego worka?
    >Jak Pan to robi,jak to możliwe?
    No, widać to możliwe, skoro to robię😉
    Jeśli jest Pan zainteresowany jak sobie radzą z tym problemem np. katolicy, to polecam http://www.opoka.org.pl/biblioteka/T/TD/praca_nad_wiara/stworzenie.html

    pozdrawiam
    Klaudiusz

  14. KingKong
    Sierpień 20, 2007 o 12:54 am

    (ciach)

    Pierwasz część postu to czysta manipulacja!

    >No, widać to możliwe, skoro to robię
    >Jeśli jest Pan zainteresowany jak sobie radzą z tym problemem >np. katolicy, to polecam >http://www.opoka.org.pl/biblioteka/T/TD/praca_nad_wiara/stworze>nie.html

    Ten artykuł nie niesie żadnych merytorycznych przyrodniczych argumentów i nie wskazuje na teologiczne konsekwencje, jakie niesie za sobą ewolucjonizm teistyczny. Ponieważ skoro człowiek to efekt długoletniej ewolucji biologicznej metodą prób i błędów, to jaką podstawe ma nauka Pisma Świętego o grzechu pierworodnym czy okupie? „Przez jednego człowieka grzech wszedł na świat,a przez grzech śmierć” uczy Biblia. Uczy tez,że przez jednego człowieka przyszło odkupienie (Jezus nazwany jest w Biblii „Drugim Adamem”). Biblia uczy, że z „jednego człowieka Bóg wyprowadził wszelkie narody”-Ewa została stworzona z ciała Adama-a więc logicznym się staje ,że jedna bezgrzeszna osoba mogła złożyć okup za dziedziców grzechu adamowego!

    Jako replike proponuje poczytać ten artykuł:

    http://www.nauka-a-religia.uz.zgora.pl/index.php?action=tekst&id=108

    Ewolucjoniści teistyczni, to fałszywi przyjaciele Biblii. To kłamcy, zakamuflowani ateiści w koloratkach, którzy w dodatku są członkami Komitetu Biologii Ewolucyjnej PAN!

    Ich nieuczciwe deklaracje, iz wiara jest zgodna z naukowym myśleniem o genezie gatunków nie opiera sie na rzeczywistości. Oficjalne stanowisko naukowe odrzuca wszelki plan i przewidywanie w ewolucji. Powołuje sie-jak autorka tego bloga-to automatycznego i bezmyslnego procesu. Procesu, który nie planuje i nie przewiduje. Do bezbożnej wizji darwinowskiego doboru naturalnego. Jeśli czuje sie Pan chrzescijaninem ,to prosze sie zastanowic kogo i czego Pan tak naprawde broni. Ludzi, którzy dali się zwieśc bezbożnej filozofii, czy Biblii, ktora jest zródłem prawdy.

    pozdrawiam.

  15. KingKong
    Sierpień 20, 2007 o 1:02 am

    >p nbsp p p font face helvetica size 3 font color 800000 magia >i gnoza br kwitnie jak nigdy br br sztuczne raje br sztuczne >piekła br sprzedawanie są na rogu ulicy br br em strong >Zbigniew Herbert strong 8211 Pan …

    To ma być cała obrona ewolucjonizmu na jaką Cię stać?
    A może ten bełkot skierowałaś do mojego katolickiego dyskutanta. Myśle ,że choć jest on ewolucjonistą (a raczej ślepym zwolennikiem TE, poniewaz żeby byc ewolucjonista należy rozumiec więcej niż propagandowe teksty ewolucjonistów w koloratkach), to jednak wierzy w katolickie piekło i raje, niemniej myślę, że mimo to pozostanie Twoim wielkim wielbicielem:)

    pozdrawiam.

  16. KingKong
    Sierpień 20, 2007 o 1:24 am

    http://www.opoka.org.pl/biblioteka/F/FB/ah_kreacjonizm.html
    Albo ten tekst. Zeby takiego ateistycznego paszkwila zamieszczać na stronie ludzi, którzy sie mienią chrzescijanami!

    CYTAT:

    „Cóż w takiej sytuacji twierdzi teistyczny ewolucjonista? Twierdzi on, że życie na ziemi powstało za sprawą mechanizmu naturalnej selekcji, i samoreplikujących się cząsteczek, natomiast za tą ewolucją i za powstaniem samo replikujących się cząsteczek stoi Bóg. Nie za uruchomieniem naturalnej selekcji, ta jest samoczynna i tautologiczna niczym prawa logiki, a mówienie o niej jako nadanej przez Boga jest niewłaściwe i mylące, lecz za pojawieniem się (niedokładnie) samoreplikujących się cząsteczek —na czego samoistne zajście szansa jest bardzo mała.”

    Cała teologiczno-ewolucyjna prawda, której brakowało w poprzednim artykule. Obrzydliwość nad obrzydliwości! Nie dlatego, że tam się pisze o Teorii Ewolucji tylko dlatego,że czyni to rzekomiy naśladowca Jezusa.

    Poza tym kłamca ,który wyprodukował tego paszkwila pisze, iż kreacjoniści nie prowadza badań naukowych na poważnych uniwersytetach. W takim razie-żeby daleko nie szukac-Michael Behe http://epm.gourl.org
    i Michael Denton http://epn.gourl.org
    zdobywali swoją wiedzę-pewnie zdaniem tego autora- w salce parafialnej?:)

  17. KingKong
    Sierpień 20, 2007 o 1:26 am

    http://www.opoka.org.pl/biblioteka/F/FB/ah_kreacjonizm.html
    Albo ten tekst. Zeby takiego ateistycznego paszkwila zamieszczać na stronie ludzi, którzy sie mienią chrzescijanami!!

    CYTAT:

    „Cóż w takiej sytuacji twierdzi teistyczny ewolucjonista? Twierdzi on, że życie na ziemi powstało za sprawą mechanizmu naturalnej selekcji, i samoreplikujących się cząsteczek, natomiast za tą ewolucją i za powstaniem samo replikujących się cząsteczek stoi Bóg. Nie za uruchomieniem naturalnej selekcji, ta jest samoczynna i tautologiczna niczym prawa logiki, a mówienie o niej jako nadanej przez Boga jest niewłaściwe i mylące, lecz za pojawieniem się (niedokładnie) samoreplikujących się cząsteczek —na czego samoistne zajście szansa jest bardzo mała.”

    Cała teologiczno-ewolucyjna prawda, której brakowało w poprzednim artykule. Obrzydliwość nad obrzydliwości! Nie dlatego, że tam się pisze o Teorii Ewolucji tylko dlatego,że czyni to rzekomiy naśladowca Jezusa.

    Poza tym kłamca ,który wyprodukował tego paszkwila pisze, iż kreacjoniści nie prowadza badań naukowych na poważnych uniwersytetach. W takim razie-żeby daleko nie szukac-Michael Behe http://epm.gourl.org
    i Michael Denton http://epn.gourl.org
    zdobywali swoją wiedzę-pewnie zdaniem tego autora- w salce parafialnej?:)

  18. KingKong
    Sierpień 20, 2007 o 3:58 am

    dobranoc

  19. KingKong (podsumowanie i żegnam)
    Sierpień 20, 2007 o 4:01 am

    Czym naprawde jest ewolucjonizm teistyczny, żeby go zdemaskowac
    posłużę się pewnym artykułem.
    http://www.opoka.org.pl/biblioteka/F/FB/ah_kreacjonizm.html
    Żeby takiego ateistycznego paszkwila zamieszczać na stronie ludzi,
    którzy sie mienią chrzescijanami, ręce opadają!

    CYTAT:

    „Cóż w takiej sytuacji twierdzi teistyczny ewolucjonista? Twierdzi
    on, że życie na ziemi powstało za sprawą mechanizmu naturalnej
    selekcji, i samoreplikujących się cząsteczek, natomiast za tą
    ewolucją i za powstaniem samo replikujących się cząsteczek stoi Bóg.
    Nie za uruchomieniem naturalnej selekcji, ta jest samoczynna i
    tautologiczna niczym prawa logiki, a mówienie o niej jako nadanej
    przez Boga jest niewłaściwe i mylące, lecz za pojawieniem się
    (niedokładnie) samoreplikujących się cząsteczek —na czego samoistne
    zajście szansa jest bardzo mała.”

    Cała teologiczno-ewolucyjna prawda! Obrzydliwość nad obrzydliwości!
    Nie dlatego, że tam się pisze o Teorii Ewolucji tylko dlatego,że
    czyni to rzekomy naśladowca Jezusa.

    Ten artykuł nie niesie żadnych merytorycznych przyrodniczych
    argumentów i nie wskazuje na teologiczne konsekwencje, jakie niesie
    za sobą ewolucjonizm teistyczny. Ponieważ skoro człowiek to efekt
    długoletniej ewolucji biologicznej metodą prób i błędów, to jaką
    podstawę ma nauka Pisma Świętego o grzechu pierworodnym czy
    okupie? “Przez jednego człowieka grzech wszedł na świat,a przez
    grzech śmierć” uczy Biblia. Uczy tez,że przez jednego człowieka
    przyszło odkupienie (Jezus nazwany jest w Biblii “Drugim Adamem”).
    Biblia uczy, że z “jednego człowieka Bóg wyprowadził wszelkie
    narody”-Ewa została stworzona z ciała Adama-a więc logicznym się
    staje ,że jedna bezgrzeszna osoba mogła złożyć okup za dziedziców
    grzechu adamowego!
    Ewolucjoniści teistyczni, to fałszywi przyjaciele Biblii. To kłamcy,
    zakamuflowani ateiści w koloratkach, którzy w dodatku są członkami
    Komitetu Biologii Ewolucyjnej PAN!
    Ich nieuczciwe deklaracje, iż wiara jest zgodna z naukowym myśleniem
    o genezie gatunków nie opiera się na rzeczywistości. Oficjalne
    stanowisko naukowe odrzuca wszelki plan i przewidywanie w ewolucji.
    Odwołuje sie za to do automatycznego i bezmyślnego
    procesu. Procesu, który nie planuje i nie przewiduje. Do bezbożnej
    wizji darwinowskiego doboru naturalnego. Czytelniku jeśli uważasz
    siebie
    za chrzescijanina ,to prosze się zastanowić kogo i czego tak
    naprawdę
    bronisz? Ludzi, którzy dali się zwieść bezbożnej filozofii, czy
    Biblii, ktora jest zródłem prawdy? Prawdy, której żadna nauka
    jeszcze nie podwazyła! A wręcz przeciwnie: potwierdziła.

    Poza tym oszust ,który wyprodukował tego pseudonaukowego paszkwila pisze, iż
    kreacjoniści nie prowadzą badań naukowych na poważnych
    uniwersytetach. W takim razie-żeby daleko nie szukac-Michael Behe
    epm.gourl.org
    i Michael Denton epn.gourl.org
    zdobywali pewnie swoją wiedzę-zdaniem tego autora- w salce
    parafialnej?:)

    pozdrawiam.

  20. Lukasz
    Sierpień 24, 2007 o 12:00 pm

    Hej Migg – jest juz druga czesc „Wrogow rozumu”. Rownie mocna a moze nawet i lepsza niz pierwsza czesc. Pierwsze piec minut po prostu rozwala…🙂 Pozdrawiam z frontu walki o PRAWDE.

  21. everythingthatcounts
    Sierpień 24, 2007 o 9:28 pm

    @KingKong

    Czytając Twoje wypowiedzi mam wrażenie, że nie jesteś do końca zorientowany w tematyce na temat, której się wypowiadasz. W szczególności z tego, co piszesz rysuje się obraz utożsamiający mechanizmy ewolucyjne jako procesy w swojej naturze czysto „losowe”, przypadkowe. Z mojego rozeznania ogólna idea ewolucji w sporym uproszczeniu jest taka, że „losowe” owszem są mutacje, które jednak następnie są konfrontowane ze środowiskiem i następuje dobór naturalny. Dla mnie wzajemny taniec losowych zmian w materiale genetycznym w połączeniu z wąskim gardłem doboru naturalnego stanowi piękną koncepcję – może Tego Ci brakuje żebyś polubił ewolucję ;)?

    Poza tym uważam za wartościowe wyszczególnienie Tobie faktu, że przytoczone przez Ciebie probabilistyczne rozważania (nie uwzględniające doboru naturalnego) dotyczą specyficznych założeń koncepcji bulionu pierwotnego, będącego jedną z wielu naukowych hipotez na temat http://en.wikipedia.org/wiki/Origin_of_life . Nawet, gdyby Twoje argumenty ją zafalsyfikowały nie zafalsyfikowałbyś http://en.wikipedia.org/wiki/Evolution do czego wyczuwam, że dążysz.

    A dodatkowo, w kontekście Intelligent Design, proponuję głębsze zapoznanie się ze znaczeniem i rolą w nauce użytego przeze mnie z wysoką premedytacją słowa falsyfikować http://en.wikipedia.org/wiki/Falsifiability . Może naświetli Ci to różnicę między wiarą a nauką, której mam wrażenie, że również nie rozumiesz.

    A Dawkinsa, z całym poszanowaniem jego intelektu i dokonań naukowych, to nie niezbyt lubię. Jakiś taki przemądrzały za bardzo i fanatyczny. Wspominam o tym żeby nie było wątpliwości, że nie Dawkinsa tutaj bronię.

    Pozdrawiam

  22. KingKong
    Sierpień 25, 2007 o 6:23 pm

    Niech kolega da spokoj,niech kolega już wyluzuje. KingKong rozumie STE i rozumie ,że selekcja naturalna składa się z przypadkowych zdarzeń,jak uderzenie komety, przypadkowej mutacji na szybszy bieg u antylopy ,ci ma napedzac ewolucje na szybszy bieg u geparda. Kiedyś napisałem tekst ,w którym pokazałem ,że selekcja naturalna w gruncie rzeczy tez jest losowa:
    ————————————————————–
    Wyobraz sobie ewolucje pletwiastej nogi
    ptaka
    wodnego. Doborem naturalnym zwiekszjacym szanse wydania licznejszego potomstwa
    jest zbiornik wodny [staw,rzeka,jezioro czy morze]. Myslac ewolucyjne jest
    czystym przypadkiem, ze istnieja takie a nie inne stale fizyczne i, ze istnieje
    woda. Jest tez czystym przypadkiem ze powstaly rzeki lub zbiorniki wodne. A
    wiec przypadek „wylosowal” takie obiekty, jak zbiorniki wodne. Teraz juz tylko
    od innego przypadku zalezy, czy ptak dostosuje sie do tych
    warunkow. Przypadkowych mutacji [„skreslania w totolotka”]. A wiec ptak uzyska
    swoja pletwiasta noge tylko w wyniku przypadkowych pozytywnych mutacji-
    wlasciwych „skreslen” i dlatego, ze przypadkowo zaistnial zbiornik wodny-stanowiacyczynnik selekcyjny dla tych przypadkowych mutacji. A wiec mozemy
    powiedziec: kaczka jest dobrze przystosowana do srodowiska wodnego, bo sie do
    niego dobrze dostosowala w wyniku tego, że przypadkowo zaistnial zbiorniki wodne:) Teraz inny przyklad obrazujacy cos, co ewolucjonisci nazywaja „Wysciegiem Zbrojen”. Wyobraz
    sobie wyspe a na niej dwa gatunki drzew i jeden gatunek robali. Robale zywia
    sie jednym gatunkiem drzew, bo drugi jest toksyczny. Nagle przez przypadek
    spada kometka-jeden z elementow przypadkowego doboru-zakwasza glebe i nieodporny gatunek
    drzew-ten ktorym odzywiaja sie robale-stopniowo wymiera. Robale musza sie
    dostosowac do spozywania toksycznych drzew. Przezywaja tylko te robale, u
    ktorych w wyniku przypadkowych mutacji [„skreslania w totka”] wyksztalca sie
    opornosc na toksyny. Teraz jesli drzewa rowniez zaczna bronic sie przed
    inwazja robali i rowniez „skreslac w totka”-mutowac zeby stac sie bardziej
    toksyczne, to te drzewa beda „losowaniem”-doborem dla robali, a
    robale „losowaniem”- doborem dla drzew….A wiec w ewolucji przypadek goni przypadek. Innymi slowy: to przypadek napedza rzekoma ewolucje..
    ————
    A co do hipotez dotyczacych przypadkowego powstania zycia , to przy obecnym, poglębionym stanie wiedzy praktycznie nic z nich nie zostało:)
    http://naz.pl/?da

    Tutaj przeprowadziłem obszerną dyskusję na ten temat i pokazałem bezspornie, że wiara w spontaniczne powstanie życia jest bezrozumnym, zaprzeczajacym wszelkiemu rozumowi sofizmatem, a nie powazna hipotezą naukową.
    I nie jest to jakiś kreacjonistyczny wymysł tylko poparte nauką empiryczną przekonanie.

    pozdrawiam.
    http://naz.pl/?db

  23. everythingthatcounts
    Wrzesień 4, 2007 o 8:05 am

    Zadałem sobie trudu przeczytać wszystkie komentarze na stronie, nawet poszedłem w te Twoje linki. Linki raczej nie wnoszą istotnych nowych informacji, poza już przez Ciebie przytoczonymi. No może oprócz pewnego kontekstu do tezy „Ewolucjoniści przyznają, że prawdopodobieństwo to wynosi..”. No i oczywiście oprócz bardzo interesującej dla mnie informacji, że jest coś takiego jak „polskie towarzystwo kreacjonistyczne”😉 – ale to już nie ma związku z dyskusją. Ograniczę się zatem do stwierdzeń tu przytaczanych.

    Swoją argumentację podważającą abiogenezę opierasz na szacunkowej odpowiedzi na pytanie „jakie jest prawdopodobieństwo przypadkowego powstania nawet całkiem prostej cząsteczki białka w bulionie pierwotnym?”. Słowo „przypadkowo” jest tutaj dość mało precyzyjnie sformułowane. Aby kontynuować spróbuję je doprecyzować tak żeby miało to jakiś sens pozwalający na licznie prawdopodobieństw mam nadzieję zgodnie z Twoją intuicją.

    Załóżmy, zatem że mamy wodną mieszankę podstawowych organicznych związków, specyficzną mieszankę gazów („atmosferę”) i wszystko to w odpowiednim ciśnieniu oraz temperaturze. Przyjmuję, że chodzi Ci o prawdopodobieństwo powstania związku o tak niskiej ENTROPI jak nawet najprostsze białko z opisanego bulionu pierwotnego. Co do faktycznych liczb to nie byłbym pewien ale intuicja mi mówi owszem, że byłoby to bardzo bardzo małe prawdopodobieństwo przy założeniu:
    a) W ODIZOLOWANYM UKŁADZIE
    lub:
    b) W KRÓTKIM CZASIE

    Pierwsze założenie odwołuje się do drugiej zasady termodynamiki – potłuczona szklanka może się sama pozbierać „do kupy”, ale jest to bardzo BARDZO nieprawdopodobne. Niestety [na szczęście ;)] wodne środowisko ziemi układem odizolowanym nie jest – z góry grzeje słoneczko a z dołu jąderko. Jak obecnie sobie z drugą zasadą termodynamiki radzą wszystkie żywe organizmy to chyba wiesz, jak nie to zastanów się skąd pochodzi energia, która napędza twoje serce do bicia i mózg do myślenia.

    Drugie założenie jest konieczne do otrzymania astronomicznie niskich, Ciebie satysfakcjonujących, prawdopodobieństw otrzymania białka z bulionu pierwotnego na ziemi, na której jednak słońce świeci a wulkany erupują. A to, dlatego że w momencie jak zupę w takim środowisku zostawisz może już po pewnym czasie $t_0+\Delta_{t1}$ nie być taką samą zupą, a zupą o niższej entropii i jakie jest wtedy prawdopodobieństwo, że powstanie kiedyś białko? A jakie jest w $t_0+\Delta_{t1}+\Delta_{t2}$?

    A teraz mała dygresja w naszej historyjce. Czemu nie sformułowałeś pytania „jakie jest prawdopodobieństwo przypadkowego powstania człowieka z wiadra węgla, wiadra wody, garści azotu atmosferycznego, kredy do tablicy i dwóch gwoździ?”. Jeżeli się dobrze zastanowić to właśnie coś takiego teoria ewolucji „sugeruje”, a oczywiste, że o ile z cyferkami w przypadku bulion->białko można się jeszcze zastanawiać to w przypadku wiadro węgla–>człowiek nie pozostawiłbyś żadnych wątpliwości. Przepaść entropiczna między wiadrem węgla, a człowiekiem jest tak kolosalna, że każdy, nawet nie słysząc nigdy o II zasadzie termodynamiki, nie pomyślałby NA PIERWSZY RZUT OKA, że coś takiego może się zdarzyć. Czemu zatem z jednej strony postawiłeś hipotetyczny bulion a z drugiej najprostsze białko? Dla mnie są tu dwa wytłumaczenia:
    1) brak zrozumienia istoty przytaczanych argumentów
    2) manipulacja

    Dlaczego manipulacja? Ponieważ dla tak postawionego problemu napierwszorzutoczny szok jest tak wielki, że następuje jednak zastanowienie kontrargument jest samonarzucający się, że tak powiem ewidentny. Każdy, kto chociaż trochę wie, co w trawie tej teorii piszczy mógłby odpowiedzieć coś w deseń:
    „KingKong coś tu pomieszałeś w swoim rozumowaniu. TE w żadnym miejscu nie sugeruje, że człowiek czy cokolwiek z współcześnie obserwowanych organizmów żywych powstał bezpośrednio z węgla. Nastąpiło to w wyniku stopniowego i długotrwałego procesu, w którym organizmy podlegały zmianom. Uśredniając po wszystkich organizmach proces ten powodował zazwyczaj obniżenie entropii, co, odwracając strzałkę czasu, oznacza, że pierwsze hipotetyczne samoreplikujące się struktury, które dały początek życiu musiałyby być bardzo proste. Poza tym nie z wiadra węgla, ale zapewne z bardzo prostych związków organicznych („bulion pierwotny”).”
    No, ale powiedzmy, że wierzę, że to nie była manipulacja, a tylko bardzo intensywna motywacja do znalezienia falsyfikatora abiogenezy, która przyćmiła zdolność do krytycznego myślenia.

    W każdym razie możemy wrócić do meritum. Powyższa dygresja nie była li tylko dygresją, ale nakreśliła rozumowanie, z którego wynika jasno, że jeżeli chcesz obliczyć górną granicę prawdopodobieństwa zajścia abiogenezy przy wyjściu z bulionu pierwotnego musisz
    1)określić entropię MINIMALNEGO organicznego układu (nazwijmy go Mou) mającego zdolność samoreplikacji mogącego być podstawą dalszej ewolucji aż do życia obserwowanego w obecnej formie na ziemi.
    2)określić prawdopodobieństwo ZAJŚCIA PROCESU (ciąg prawdopodobieństw warunkowych, proces stochastyczny) umożliwiającego powstanie Mou opisanego w punkcie pierwszym, mając w momencie startowym coś w rodzaju bulionu pierwotnego, a w międzyczasie warunki panujące na ziemi onegdaj.
    Zadanie wydaje mi się wprost za…iście ciekawe, czekam na odpowiedź;)
    W momencie, w którym jednak przyjmujemy istnienie hipotetycznego Mou na mocy reguł TE powstanie w pewnym momencie najprostszego białka jak i człowieka należy uznać za niewykluczone na gruncie probabilistycznym.

    W związku z powyższym postawioną przez Ciebie tezę „pokazałem bezspornie” należy uznać za przedwczesną, tudzież trochę zuchwałą. To, co się w tej chwili stało jest odpowiednim momentem żeby Cię odesłać do linka http://en.wikipedia.org/wiki/Peer_review . Wydaje mi się, że powinieneś w ogóle trochę poświęcić czasu na poczytanie więcej poważnych naukowych podręczników oraz czasopism i najlepiej nie dotyczących ewolucji, bo budzi w tobie ten temat zbyt dużo emocji. Taka lektura uczy pokory. No i może zrozumiałbyś też czego brakuje kreacjonizmowi.

    I jeszcze jedna rzecz. TE jest modelem teoretycznym. Wydaje mi się, że z niewielkim trudem dałoby się przeprowadzić komputerową symulację, w której pewne matematyczne obiekty zdefiniowano by w taki sposób, aby miały zdolność do niedoskonałej replikacji i zróżnicowane w zależności od pewnego relatywnie stałego kryterium prawdopodobieństwo przeżycia. Można zrobić drugą symulację, w której wszystkie warunki są takie same oprócz tego, że prawdopodobieństwo przeżycia jest niezależne od kryterium. Masz jakieś intuicje, co się stanie? Jest to czysta matematyka, minimalizacja funkcji straty, maksymalizacja funkcji wiarygodności, samograja.

    Jak każdy niesprzeczny model teoretyczny TE sama w sobie jest zatem tautologią. Wielkie pytanie brzmi natomiast czy TE ma jakieś zastosowanie w wytłumaczeniu otaczającego nas świata biologicznego. Jak w przypadku każdej NAUKOWEJ teorii pytanie to jest weryfikowane poprzez wyciąganie z modelu wniosków o charakterze empirycznym i porównywanie ich z rzeczywistością. Zadaj sam sobie, to pytanie, ale tak naprawdę szczerze, na przykład w momencie jak lekarz mówi Ci żebyś zmienił antybiotyk.

    Życzę powodzenia w Twoich dociekaniach

    Everythingthatcounts

  24. KingKong
    Wrzesień 13, 2007 o 4:04 pm

    Drugie prawo termodynamiki nie ma nic wspólnego z problemem
    powstania życia. Tutaj muszą być spełnione różne ,koniecznie
    wymagane warunki biochemiczne. Aminokwasy muszą potrafić łączyć się
    w dłuższe polipeptydy spontanicznie i w odpowiedznim środowisku
    katalitycznym:

    -Nie potrafią tego, co pokazują doświadczenia (z dużą pomocą
    człowieka powstają in vitro jedynie krótkie peptydy).
    Do tego potrzebne są rybosomy (translakcja).

    -Muszą potrafić łączyć się w odpowiedniej kolejności, a nie w jakie
    kolwiek układy złożone (sekwencji).
    Nawet jakby aminokwasy potrafiły organizować się samoistnie w
    większe łąńcuchy polipeptydowe, to w jaki sposób wyeliminować
    wszelkie szkodliwe L-aminokwasy, P-aminokwasy (które doprowadzają po
    włączeniu do destrukcji w funkcjonalnym polipeptydzie z jego
    denaturacją włącznie-stwierdzone doświadczalnie!),a wyselekcjonować
    w racemacie tylko 20 tych potrzebnych L-aminokwasów i ułożyć je w
    odpowiedniej sekwencji, któraby pozwalała na ich funkcjonalność
    gourl.org/ex5 ?

    Jakiś naturalistyczny cud musiałby spowodować wielokrotne i w jednym
    czasie i miejscu powtanie różnych funkcjonalnych enzymów, w obrębie
    jakiejś błony, i równoczesne powstanie w tym samym czasie i miejscu
    adekwatnego kodu genetycznego.

    Te same problemy dotyczą powstania kodu genetycznego. Dłuższe
    łańcuchy polinukleotydowe, czy polirybonukleotydowe powstają tylko w
    specjalnych warunkach,jakie panują w żywych organizmach. W warunkach
    in vitro powstają jedynie króciutkie sekwencje-losowe-na specjalnych
    preparatach umożliwiających ich katalize. Teoretrycznie w
    hipotetycznym ryboracemacie do powstania funkcjonalnych łańcuchów
    polirybonukleotydowych musiałyby być spełnione analogiczne
    warunki,jak podczas powstawania funkcjonalnych polipeptydów w
    racemacie. Do powstania funkcjonalnych polipeptydów potrzebna jest
    złożona matryca mRNA,a do powstania tej matrycy złożona matryca DNA
    i złożone białka powstające na bazie tych matrycy. A więc dylemat w
    rodzaju kura czy jajo…
    gourl.org/ex6 ?

    Zywa komórka to twór nieredukowalnie złożony ,są granice jej
    redundancji. Żeby taka dobrze funkcjonowała taka transkrypcyjno-
    translacyjna maszyneria biochemiczna musi istnieć odpowiednia
    maszyneria transkrypcyjno-translacyjna. Jeśli ktoś zna jakiś inny
    model żywego organizmu, który mógłby być protobiontem , to niech go
    opisze w formie eksperymentu myślowego.

    Szymborski kiedyś napisał,iż wszelkie wyjaśnienia dotyczące
    powstania życia na drodze ewolucji chemicznej zamykają się w
    gołosłownym stwierdzeniu: życie powstało stopniowo.

    pozdr.

  25. Wrzesień 14, 2007 o 12:11 pm

    everythingthatcounts,

    Chapo ba /czy jakoś tak😉 /, dzięki za interesujący wykład. Przeczytałem z wypiekami na twarzy.

    Nie odnosisz wrażenia, że „PRAWDA”, szukanie jej za wszelką cenę, powoduje, że niektórzy współplemieńcy staja sie niewrażliwi na cudzy rozum? Zajmują sie tylko konstrukcjami powstałymi w ich własnym… Tworzą cudowne „budowle”, czyniąc je, w zasadzie, zrozumiałymi tylko dla nich.

    I przestaje być ważne, że dyskusja toczy sie w sferze KONSTRUKCJI INTELEKTUALNYCH… Zatem PRAWDOPODOBNYCH a nie PRAWDZIWYCH.

    Gdy widze u kogoś chęć by „PRAWDOPODOBNE” stało sie „JEDYNIE PRAWDZIWE”, intuicyjnie kieruje moja uwagę juz nie na TEMAT, lecz na osobnika HOMO SAPIENS, domniemując iż, użyje on wszelkich środków by NIEZALEŻNIE od INTELEKTU by swoją RACJĘ udowodnić, i oczywiście przymrużam oko o tak:😉 !

    ***
    Moja INTUICJA, podpowiada mi również, że powinienem „KingKong” zadedykować dykteryjkę taką:

    – Tatusiu czy czarownice potrafią latać?
    – Nie ma czarownic synku.
    – Ależ tatusiu, ja nie pytam się czy czarownice są czy ich nie ma tylko czy potrafią latać.

    Ponieważ, to moja intuicja, nie odpowiem na pytanie dlaczego „KingKong” dedykuje powyższe.

    Pozdrawiam serdecznie

  26. KingKong-dodatek do tekstu.
    Wrzesień 14, 2007 o 8:51 pm

    Ale ty chyba dyskutujesz z sobą i o swoich poglądach,ponieważ nie zauważyłem merytorycznej repliki na moje (a właściwie wynikające z obecnego stanu wiedzy) argumenty.
    Wiesz wielu ludzi cierpi na pewną przypadłość,zowie się ona impotencja intelektualna. Objawia się tym ,że mimo wielkiego podniecenia nie można dostać jakoś wzwodu mózgu…no niestety wiagry na to jeszcze nie wynaleziono,ale jest rada: trzeba się dużo uczyć,niemniej nie próbować być mądrzejszym od Pana Boga:)

    Pozdrawiam:
    Sławek.

  27. everythingthatcounts
    Wrzesień 15, 2007 o 2:02 am

    –>KingKong

    „Drugie prawo termodynamiki nie ma nic wspólnego z problemem powstania życia.”

    Drugie prawo termodynamiki daje Twoim wywodom dotyczącym niskiego prawdopodobieństwa zajścia abiogenezy ścisły, konieczny do przeprowadzenia stosownych obliczeń kontekst. Konstruujesz przestrzeń fazową i się zastanawiasz, jakie jest prawdopodobieństwo przejścia wszechświata ze stanu, w którym na ziemi nie było życia do stanu, w którym życie jest. Bez drugiej zasady termodynamiki poruszanie się po takiej przestrzeni fazowej byś miał dość utrudnione. Dla uproszczenia weźmy nie zajmujesz się całym wszechświatem, a zastanawiasz się nad możliwością powstania wspomnianego Mou na ogrzewanej przez słońce ziemi.

    Właśnie!? nie wiem dlaczego wyskoczyłem, że „organiczny układ”, zatem odtąd zamiast Mou będzie Mum – minimalny układ materii.. Hihi, niekoniecznie organiczna Matka wszelkiego życia:]

    Wracając, problem jest bardzo trudny. Chociażby, dlatego że nie wiesz jak bardzo Mum jest de facto skomplikowany, czyli nie wiesz, jaką ma entropię. Poruszamy się cały czas po terenie czysto teoretycznym, czyli robimy matematykę. I matematycznie Mum można w sposób jasny zdefiniować jako infimum po entropii wszelkich materialnych układów umożliwiających zachodzenie ewolucji (entropię rozumiem w tym momencie nie Shannonowsko tylko jako „miarę nieupożadkowania”). Układem materialnym umożliwiającym ewolucje jest na przykład cała obecna biosfera, ale to jest akurat totalnie odwrotne ekstremum😉.

    Proszę spróbuj takie prawdopodobieństwo jakoś oszacować, albo napisz mi, w którym momencie źle definiuję problem. Jeżeli tego nie zrobisz to powtarzam, że postawioną przez Ciebie tezę „pokazałem bezspornie” niestety należy pozostawić w szufladce przedwczesnych i zuchwałych.

    A dla jasności:
    1) „Aminokwasy muszą potrafić łączyć się w dłuższe polipeptydy spontanicznie i w odpowiedznim środowisku katalitycznym:” albo „Do tego potrzebne są rybosomy (translakcja).”
    Mnie tam nie było. Co musi to na Rusi. Chodzi, żeby powstały takie Mum, które w efekcie dadzą życie od pewnego momentu bazujące na aminokwasach i białkach. Ponieważ chcesz udowodnić tak ogólne stwierdzenie, że z materii nieożywionej to jest nieprawdopodobne musisz rozważyć WSZYSTKIE teoretycznie możliwe mechanizmy, jakimi to mogło nastąpić.
    Rozpatrzenie WSZYSTKICH teoretycznie możliwych mechanizmów jest absolutnie niepodważalną logiczną koniecznością abyś obronił swoją tezę o takim poziomie ogólności. A zdania typu: „Jeśli ktoś zna jakiś inny model żywego organizmu, który mógłby być protobiontem, to niech go opisze w formie eksperymentu myślowego” po prostu są śmieszne. Właśnie o to chodzi, że żebyś mógł obronić tezę o absurdalności abiogenezy to Ty musisz znać WSZYSTKIE inne modele Mum, obliczyć ich entropię, wybrać ten o najmniejszej i wtedy liczyć jakieś prawdopodobieństwa żeby mnie przekonać. To, że obecne teorie sobie z tym mogą czy nie mogą poradzić nie ma w tym kontekście żadnego znaczenia.
    2)A słowa „spontanicznie”, to używasz naprawdę bez większego zastanowienia skoro nie widzisz związku z drugą zasadą termodynamiki. Zwłaszcza znamienne jest tu stwierdzenie „Nie potrafią tego, co pokazują doświadczenia (z dużą pomocą człowieka powstają in vitro jedynie krótkie peptydy)„ – jasne, że nie potrafią w takim rozumieniu jak „ spontanicznie in vitro w laboratorium” a nie potrafią właśnie dlatego, że PRZECZYŁOBY TO II-GIEJ ZASADZIE TERMODYNAMIKI i również dlatego człowiek musi im w powstawaniu „dużo pomagać”. A ile milionów lat taki eksperyment trwał, że tak spytam a marginesie?

    Polecam http://lifeorigin.org/ zakładkę discussion, ale tak właściwie cały tekst powinien wydać Ci się interesujący. Powinien nakreślić Ci może jakąś jasność, co do roli drugiej zasady termodynamiki w ewolucji oraz jak w sposób ścisły i precyzyjny definiować naukowe problemy wokół początków życia. Powinien także pokazać coś o rozumowaniu i mentalności naukowców wokół tematyki, o której teraz piszesz. W szczególności nikt nie przeczy, że:
    „A phase space of stochastic ensembles has never been observed to produce even the simplest of biochemical pathways.”
    Z czego bynajmniej nie wynika wcale implikacja o bezzasadności abiogenezy. Wynika implikacja o zasadności stworzenia naukowego konkursu…

    „Żywa komórka, to twór nieredukowalnie złożony, są granice jej redundancji..”
    Rozumiem deux ex machina jako jedyna odpowiedź na oczywiste ograniczenia ludzkiego poznania i możliwości symulacji zachowania złożonych układów fizycznych. Na mój gust deux jest redundantny i pozostaje machina😉 Ale o gustach się nie dyskutuje…

    „Szymborski kiedyś napisał..”
    Pisać i mówić jest łatwo. Coś udowodnić już trudniej.

    Na koniec chciałbym wyrazić uznanie dla Twojego nicka. Kreacjonista z jajem rozumiem😉

    Pozdrawiam,

    everythingthatcounts

  28. everythingthatcounts
    Wrzesień 15, 2007 o 2:43 am

    –>Witold Skaczkiewicz

    KK zaciekawił mnie tym całym kreacjonistycznym ruchem i ponetowałem sobie trochę. Na jednym forum dorwałem dłuuugą i nawet na poziomie, dyskusję między „ateistycznym ewolucjonistą” i „teistycznym kreacjonistą”. Kreacjonista popełnił wypowiedź:
    „It is not about being able to say that design is true if evolution is torn down. It’s about saying that the design inference is valid if naturalism can be reasonably ruled out. (in other words one cannot assume design except by ruling out chance and nature)”
    Podejrzewam, że z podobnych właśnie powodów KK walczy. Stwierdził, że ewolucja przeczy jego wierze, co przy dosłownym rozumieniu niektórych fragmentów biblii może być prawdą. Zatem, z pewnej strony należy się szacunek za próbę zbudowania koherentnego spojrzenia na świat, a nie uciekania w jakąś bezrefleksyjną nibytowiarę.

    Przy takiej motywacji zrozumiała jest skłonność do kategorycznego myślenia, emocjonalności, szukania dziury w całym za wszelką cenę bez względu na to co może podpowiadać rozsądek. Ciekawe do czego w konsekwencji KingKong dojdzie😉

    Pozdrawiam,

    everythingthatcounts

    PS –> Migg, mam nadzieję, że nie gniewasz się za te traktaty. Założę kiedyś własny blog i może nie będę się musiał wyżywać u innych… Anyhow, dzięki za gościnę🙂

  29. Wrzesień 15, 2007 o 2:16 pm

    everythingthatcounts,

    doprawdy, wielka to przyjemność czytać co piszesz.

    Serdecznie pozdrawiam

  30. KingKong
    Wrzesień 15, 2007 o 4:49 pm

    >Stwierdził, że ewolucja przeczy jego wierze….

    Wiara nie ma tu nic do rzeczy,ponieważ neodarwinizm najpierw przeczy faktom naukowym….Poza tym nauka jest zgodna ze Słowem Bożym,więc nie widzę powodu do niepokoju:
    http://gourl.org/ezv

    Poza tym nie wiem czy zauważyłeś ,ale zdryfowałeś z tematu,bo o czym w końcu gadamy: o biologii ,czy teologii? Jeśli okazałoby się,że treść Biblii przeczy jakiejś bezpornej rzeczywistości, to i tak owy fakt miałby się nijak do poglądu ,iż życie powstało w sposób przypadkowy.

    pozdrawiam.

  31. KingKong
    Wrzesień 15, 2007 o 5:04 pm

    1) „Aminokwasy muszą potrafić łączyć się w dłuższe polipeptydy spontanicznie i w odpowiedznim środowisku katalitycznym:” albo „Do tego potrzebne są rybosomy (translakcja).”

    everythingthatcounts:
    Mnie tam nie było. Co musi to na Rusi. Chodzi, żeby powstały takie Mum, które w efekcie dadzą życie od pewnego momentu bazujące na aminokwasach i białkach. Ponieważ chcesz udowodnić tak ogólne stwierdzenie, że z materii nieożywionej to jest nieprawdopodobne musisz rozważyć WSZYSTKIE teoretycznie możliwe mechanizmy, jakimi to mogło nastąpić.

    KingKong:

    Więc zamiast tego gołosłowia zaproponuj jakiś choć jeden alternatywny shemat życia, które mogłoby powstać przez samoorganizację na jaką pozwala II prawo termodynamiki, a następnie opisz protościeżki (używając eksperymentu myślowego) ,jakimi ten wyimaginowany protobiont przekształcił się we współczesne życie.

    Twoje wymigiwanie się od podjęcia dyskusji na płaszczyznie meritum problemu i zwalanie winy na impotencje nauki ,która nie wynalazła jeszcze wehikułu czasu nie zwalnia cię od obowiązku dowiedzenia swoich postulatów chociaż przy pomocy wiarygodnego modelu teoretycznego. Ja jestem w lepszej sytuacji-to fakt, ponieważ mogę korzystać z dostępnych świadectw empirycznych i nie mam obowiązku dowodzić istnienia jakichś niezidentyfikowanych sposobów samoistnego powstawania życia (dowodzenia antytezy,iż nie istnieją sposoby powstawania życia),ponieważ wystarczy,jak wykaże błędy w waszej argumentacji. Nie muszę też pokazuwać mechanizmów kreacji,których tak się domagacie przyparci do muru (czepialstwo z braku argumentów), ponieważ (co przyznał nawet Richard Dawkins) maszyneria transkrypcyjno-translacyjna ma WSZELKIE cechy układu specjalnie zaprojektowanego. Projektu ,którego samoistnego powstawania nauka nie zna!

    pozdrawiam.

  32. KingKong
    Wrzesień 15, 2007 o 5:11 pm

    A to dla tych, którzy prawdziwością/nieprawdziwościa tekstu biblijnego próbują dowodzić prawdziwość/nieprawdziwość przekonania o spontanicznym powstaniu życia.

    Czy nauka dowiodła, ze Biblia się myli?
    http://www.rumburak.friko.pl/BIBLIA/biblia/slowo_boze/08.php

    pzdr.

  33. KingKong
    Wrzesień 15, 2007 o 5:12 pm

    A to dla tych, którzy prawdziwością/nieprawdziwościa tekstu biblijnego próbują dowodzić prawdziwość/nieprawdziwość przekonania o spontanicznym powstaniu życia.

    Wrzuć w google,bo filter nie przepuszcza tekstów z linkami.
    Czy nauka dowiodła, ze Biblia się myli?

    pzdr.

  34. KingKong
  35. KingKong
    Wrzesień 15, 2007 o 5:25 pm

    Znalazłem też darmową wersję elektroniczną. Proszę w google wrzucić tytuł: Biblia. Słowo Boże czy ludzkie?

    Niestety linka nie podeśle,ponieważ właściciel bloga tak ustawił ustawienia,że linki rzadko przechodzą. Nie wiem ,może to z zazdrości,a może miggaweczka chce sobie przyswoić monopol na prawę.
    I nie uważam żeby było za co miggawke przepraszać, w końcu sama umożliwiła dyskusję o tekstach i myślę,że powinna się cieszyć z tak wysokiej frekwencji na jej blogu,ponieważ rzadko się to zdarza na blogach, których w sieci jest dzisiaj na pęczki.

    pozdrawiam.

  36. KingKong
    Wrzesień 15, 2007 o 5:26 pm

    Znalazłem też darmową wersję elektroniczną. Proszę w googl wrzucić tytuł: Biblia. Słowo Boże czy ludzkie?

    Niestety linka nie podeśle,ponieważ właściciel bloga tak ustawił ustawienia,że linki rzadko przechodzą. Nie wiem ,’może to z zazdrości,a może miggaweczka chce sobie przyswoić monopol na prawę.
    I nie uważam żeby było za co miggawke przepraszać, w końcu sama umożliwiła dyskusję o tekstach i myślę,że powinna się cieszyć z tak wysokiej frekwencji na jej blogu,ponieważ rzadko się to zdarza na blogach, których w sieci jest dzisiaj na pęczki.

    pozdrawiam.

  37. everythingthatcounts
    Wrzesień 15, 2007 o 11:35 pm

    –> KingKong

    Bardzo mi przykro, ale chyba odleciałeś😦 Spróbujmy pozbierać fakty…

    To Ty wyszedłeś z tezą, że powstanie życia z materii nieożywionej jest absurdalnie mało prawdopodobne. W konsekwencji ja sformułowałem dwie następujące sugestie:
    I. przestrzeń probabilistyczna do obliczeń, które przywoływałeś została zdefiniowana w sposób błędny, co by wskazywało na niezrozumienie istoty problemu (błąd nieświadomy) bądź manipulację (błąd świadomy).
    II. aby udowodnić PONAD WSZELKĄ WĄTPLIWOŚĆ (co sugerowałeś iż udało ci się zrobić) niemożliwość zajścia abiogenezy, z czysto logicznej analizy stwierdzenia „ponad wszelką wątpliwość” należy rozpatrzyć przestrzeń wszystkich potencjalnych możliwości jakimi mogło by to zajść, a nie tylko, te które obecnie podaje nauka czy ktokolwiek inny a następnie wskazać, że każda z nich jest błędna.

    Obydwie tezy zostały poparte argumentacją, do której mógłbyś się odwołać. Wręcz explicite do pierwszej sformułowałem prośbę:
    „Proszę spróbuj takie prawdopodobieństwo jakoś oszacować, albo napisz mi, w którym momencie źle definiuję problem”.

    Natomiast w odpowiedzi dostaję:

    „Twoje wymigiwanie się od podjęcia dyskusji na płaszczyznie meritum problemu i zwalanie winy na impotencje nauki ,która nie wynalazła jeszcze wehikułu czasu nie zwalnia cię od obowiązku dowiedzenia swoich postulatów chociaż przy pomocy wiarygodnego modelu teoretycznego. Ja jestem w lepszej sytuacji-to fakt, ponieważ mogę korzystać z dostępnych świadectw empirycznych i nie mam obowiązku dowodzić istnienia jakichś niezidentyfikowanych sposobów samoistnego powstawania życia (dowodzenia antytezy,iż nie istnieją sposoby powstawania życia),ponieważ wystarczy,jak wykaże błędy w waszej argumentacji. Nie muszę też pokazuwać mechanizmów kreacji,których tak się domagacie przyparci do muru (czepialstwo z braku argumentów), ponieważ (co przyznał nawet Richard Dawkins) maszyneria transkrypcyjno-translacyjna ma WSZELKIE cechy układu specjalnie zaprojektowanego. Projektu ,którego samoistnego powstawania nauka nie zna!”

    What a f*ck?! Mam wrażenie, że chyba pomyliły ci się zakładki w przeglądarce. Nie chcę żebyś mi pokazywał mechanizmy kreacji, a co do postawionych przeze mnie postulatów (I.&II. powyżej) z przyjemnością mogę się wdać w dalszą dyskusję, tylko nie będę tego przecież robił sam ze sobą..
    Jakiej „waszej argumentacji” swoją drogą? Jacy przyparci? Widzisz podwójnie?

    Ziemia wzywa KingKonga i jego intelektualną przyzwoitość.

    Peace&love

    everythingthatcounts

    PS ale między wierszami widzę, że Drugieprawotermodynamikiniemanicwspólnegozproblemempowstaniażyciarurka zmiękła, co traktuję jako bardzo miły akcent😉

  38. everythingthatcounts
    Wrzesień 15, 2007 o 11:40 pm

    ->Witold Skaczkiewicz

    A widzisz, na przykład KK-owi chyba inaczej się to czyta😉
    Różnice indywidualne między ludźmi czynią świat naprawdę, hmm…, interesującym miejscem.

    Dzięki za miłe słowo, pozdrawiam

  39. Wrzesień 16, 2007 o 12:14 pm

    everythingthatcounts,

    oj, widzę…
    Mam podobną wpadkę…🙂 lecz odczuwam zmęczenie. Spotkanie z Tym co piszesz to wznowienie wiary, że świat jest „interesującym miejscem”

    Dziękuje.

  40. Lukasz
    Wrzesień 17, 2007 o 1:39 pm

    everything counts – jestem pelen podziwu dla argumentacji. Takiego podejscia nam potrzeba w nauce, zeby przekonywac o prawdziwosci budowy swiata. Ze tak z ciekawosci zapytam – jestes biologiem?

  41. KingKong
    Wrzesień 24, 2007 o 3:24 pm

    To Ty wyszedłeś z tezą, że powstanie życia z materii nieożywionej jest absurdalnie mało prawdopodobne.

    KK
    Samorzutne powstanie zycia jest niemozliwe!!!!!!
    Dlaczego uwazasz,ze jest to absurdalna teza, toz takie przekonaie fakty naukowe popżieraja!

    Skoro mimo rozwoju nauki nie udało się udowodnić, że życie może powstać samoistnie, to dlaczego niektórzy naukowcy w dalszym ciągu popierają takie teorie? Kilkadziesiąt lat temu profesor J.D.Bernal rzucił na tę sprawę sporo światła w książce The Origin of Life (Pochodzenie życia): „Gdyby do tego zagadnienia [samoistnego powstania życia] ściśle zastosować reguły metody naukowej, w kilku miejscach tej historii można byłoby w gruncie rzeczy wykazać, jak życie powstać nie mogło — nieprawdopodobieństwo było zbyt wielkie, szansę pojawienia się życia zbyt nikłe”…………. Profesor Michael J.Behe oświadczył: „Kto nie uważa za konieczne szukać wyjaśnienia jedynie wśród nierozumnych czynników sprawczych, łatwo dojdzie do wniosku, że wiele systemów biochemicznych zostało zaprojektowanych — zaprojektowanych nie przez prawa natury, nie przez przypadek i konieczność, lecz zaplanowanych. (…) Życie na ziemi na swym najbardziej podstawowym poziomie, wszystkie jego najważniejsze elementy, to wynik rozumnej działalności”.

    pozdr.

  42. KingKong
    Wrzesień 24, 2007 o 3:38 pm

    What a f*ck?! Mam wrażenie, że chyba pomyliły ci się zakładki w przeglądarce. Nie chcę żebyś mi pokazywał mechanizmy kreacji, a co do postawionych przeze mnie postulatów (I.&II. powyżej) z przyjemnością mogę się wdać w dalszą dyskusję, tylko nie będę tego przecież robił sam ze sobą..

    KK
    Ty przeciez nie dyskutujesz, tylko uprawiasz onanizm erystyczny. Nie rozumiem jak na podstawie tego,co tu wyprodukowales ktokolwiek mogl wywnioskowac ,ze jestes biologiem…..jaka wiedza taka subiektywnosc.

    Miggaweczka w przeciwienstwie do ciebie ma troche wiecej oleju w glowie i zdaje sobie sprawe,czytajac co pisze,jak i znajac stan aktualnej wiedzy na ten temat, ze w przedmiocie biogenezy jest na calkowicie przegranej pozycji z kreacjonistami. No coz,ale miggawka to chyba studentka biologii ,wy nawet nie…ja jestem po Akademii Rolniczej o kierunku hodowli, przy zastosowaniu osiagniec genetyki populacyjnej,moglem wybrac specjalnosc genetyki.

  43. KingKong
    Wrzesień 24, 2007 o 3:46 pm

    PS ale między wierszami widzę, że Drugieprawotermodynamikiniemanicwspólnegozproblemempowstaniażyciarurka zmiękła, co traktuję jako bardzo miły akcent😉

    KK
    Przeciez od poczatku tlumacze ,ze II prawo termodynamiki w samorzutnym powstaniu zycia nie pomaga. I badz uprzejmy nie zachowywac sie jak malolat i zacznij robic spacje miedzy wyrazami kiedy cos piszesz, poniewaz wogole ciezko cokolwiek wylowic z twojego belkotu,a jak jeszcze w ten sposob zaczynasz pajacowac, to juz calkiem odchodzi chec walenia grochem o sciane.

  44. KingKong
    Wrzesień 24, 2007 o 10:16 pm

    Przeciętne białko składa się ze stu aminokwasów (kodowanych przez 300nukleotydowy kod genetyczny).
    Potrzebnych jest jakieś 500/600 do funkcjonowania
    prostego życia:

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5

    W ŚCIŚLE OKREŚLONEJ SEKWENCJI!

    Pamiętaj też ,że na bazie tych 600set genów muszą powstawać białka
    złożone ze 100 aminokwasów, które też jakoś musiałyby same ,w tym
    samym miejscu i pasujące do tego kodu genetycznego jakoś same
    powstać;

    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    CZY DALEJ UWAŻASZ,ŻE KTOŚ NIE ŻENI CI KITU
    WMAWIAJĄC,IŻ PRZEŚWIADCZENIE O SAMORZUTNYM POWSTANIU ŻYCIA JEST
    ZGODNE Z MATEMATYKĄ I UCZCIWYM NAUKOWYM ŚWIATOPOGLĄDEM?

    A jak będzie wyglądał cały DNA dla tych 600set białek (o białkach
    też nie zapominaj). Coś dla wyobrazni wszystko i tak się nie zmieści.
    PRZYPOMINAM,ŻE TO WSZYSTKO MUSI POWSTAĆ W JEDNYM MIEJSCU I O JEDNYM CZASIE!

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5

    W ŚCIŚLE OKREŚLONEJ SEKWENCJI!

    Pamiętaj też ,że na bazie tych 600set genów muszą powstawać białka
    złożone ze 100 aminokwasów, które też jakoś musiałyby same ,w tym
    samym miejscu i pasujące do tego kodu genetycznego jakoś same
    powstać;

    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    CZY DALEJ UWAŻASZ,ŻE KTOŚ NIE ŻENI CI KITU
    WMAWIAJĄC,IŻ PRZEŚWIADCZENIE O SAMORZUTNYM POWSTANIU ŻYCIA JEST
    ZGODNE Z MATEMATYKĄ I UCZCIWYM NAUKOWYM ŚWIATOPOGLĄDEM?

    A jak będzie wyglądał cały DNA dla tych 600set białek (o białkach
    też nie zapominaj). Coś dla wyobrazni wszystko i tak się nie zmieści.
    PRZYPOMINAM,ŻE TO WSZYSTKO MUSI POWSTAĆ W JEDNYM MIEJSCU I O JEDNYM CZASIE!

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5

    W ŚCIŚLE OKREŚLONEJ SEKWENCJI!

    Pamiętaj też ,że na bazie tych 600set genów muszą powstawać białka
    złożone ze 100 aminokwasów, które też jakoś musiałyby same ,w tym
    samym miejscu i pasujące do tego kodu genetycznego jakoś same
    powstać;

    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    CZY DALEJ UWAŻASZ,ŻE KTOŚ NIE ŻENI CI KITU
    WMAWIAJĄC,IŻ PRZEŚWIADCZENIE O SAMORZUTNYM POWSTANIU ŻYCIA JEST
    ZGODNE Z MATEMATYKĄ I UCZCIWYM NAUKOWYM ŚWIATOPOGLĄDEM?

    A jak będzie wyglądał cały DNA dla tych 600set białek (o białkach
    też nie zapominaj). Coś dla wyobrazni wszystko i tak się nie zmieści.
    PRZYPOMINAM,ŻE TO WSZYSTKO MUSI POWSTAĆ W JEDNYM MIEJSCU I O JEDNYM CZASIE!

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5

    W ŚCIŚLE OKREŚLONEJ SEKWENCJI!

    Pamiętaj też ,że na bazie tych 600set genów muszą powstawać białka
    złożone ze 100 aminokwasów, które też jakoś musiałyby same ,w tym
    samym miejscu i pasujące do tego kodu genetycznego jakoś same
    powstać;

    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    CZY DALEJ UWAŻASZ,ŻE KTOŚ NIE ŻENI CI KITU
    WMAWIAJĄC,IŻ PRZEŚWIADCZENIE O SAMORZUTNYM POWSTANIU ŻYCIA JEST
    ZGODNE Z MATEMATYKĄ I UCZCIWYM NAUKOWYM ŚWIATOPOGLĄDEM?

    A jak będzie wyglądał cały DNA dla tych 600set białek (o białkach
    też nie zapominaj). Coś dla wyobrazni wszystko i tak się nie zmieści.
    PRZYPOMINAM,ŻE TO WSZYSTKO MUSI POWSTAĆ W JEDNYM MIEJSCU I O JEDNYM CZASIE!

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5

    W ŚCIŚLE OKREŚLONEJ SEKWENCJI!

    Pamiętaj też ,że na bazie tych 600set genów muszą powstawać białka
    złożone ze 100 aminokwasów, które też jakoś musiałyby same ,w tym
    samym miejscu i pasujące do tego kodu genetycznego jakoś same
    powstać;

    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    CZY DALEJ UWAŻASZ,ŻE KTOŚ NIE ŻENI CI KITU
    WMAWIAJĄC,IŻ PRZEŚWIADCZENIE O SAMORZUTNYM POWSTANIU ŻYCIA JEST
    ZGODNE Z MATEMATYKĄ I UCZCIWYM NAUKOWYM ŚWIATOPOGLĄDEM?

    A jak będzie wyglądał cały DNA dla tych 600set białek (o białkach
    też nie zapominaj). Coś dla wyobrazni wszystko i tak się nie zmieści.
    PRZYPOMINAM,ŻE TO WSZYSTKO MUSI POWSTAĆ W JEDNYM MIEJSCU I O JEDNYM CZASIE!

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-

    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-
    O-O-O-O-D-D-H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-F-G-H-N-N-N-
    Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D-S-T-R-M-S-D-O-O-O-O-O-O-O-D-D-
    H-H-S-Y-S-N-D-G-S-M-M-O-M-S-N-N-N-D-H-E-O-M-
    3ATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTA
    CTCCCGTTAACGTACTGTACTCCCGTTAACATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCC
    CGTTAACGTACTGGTAATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGC
    TGATTCCGTAGCGGGTCCCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTGATTCCGTAGCGGGTC
    CCATCCCGTCCGGATCGGTACTCCCGTTAACGTACTG5
    F-G-H-N-N-N-Y-U-U-U-W-N-N-N-S-O-O-O-D-J-J-H-H-H-D

  45. KingKong
    Wrzesień 24, 2007 o 10:21 pm

    Przepraszam Miggawko,że tym moim ostatnim na tym forum postem zająłem tyle miejsca,ale może w ten sposób co do niektórych przemówią fakty. Jeśli chcesz usuń post,bo wiem,że jest niewygodny, to to zrób.Ale najpierw niech każdy sobie go obejrzy.

    pozdrawiam i żegnam.

  46. Wrzesień 25, 2007 o 9:05 am

    KingKong
    dla mnie bomba!

    Szkoda, ze pomyliłeś się w 97 inni. Zatem wg. tego co tu napisałeś FIGA!

    Pomyliłeś się tez w innych liniach. Sądzę, że łatwo znajdziesz i zrozumiesz.

    Wiele czasy zużyłeś, by udowodnić swoje racje, lecz taka durna „pomyłka”… Byłbyś zapewne bardziej wiarygodny gdybyś ukazał swoje racje poprawnie i nieco prostszy sposób.

    Serdecznie pozdrawiam.🙂
    ps.
    znalazłem jeszcze 4 błędy, na więcej nie mam czasu.😦

  47. KingKong
    Wrzesień 26, 2007 o 6:01 pm

    Odkryto bakterie z króttszymi genomami niż te złożone z 600000 pz,ale oczywiście jak i te z 600000pz,są one zależne od bardziej złożonych organizmów,na zasadzie mutualizmu (coś jak mitochondria i plastydy).

    http://www.biotechnolog.pl/news-422.htm
    „Pomimo, że DNA obu bakterii prawie nie zwiera
    elementów „śmieciowych” (nie kodujących białka), prawdopodobnie nie
    są one zdolne do samodzielnego życia. Obie bakterie zaliczane są do
    organizmów symbiotycznych występujących w komórkach innych zwierząt.

    Carsonella ruddii, żyje w komórkach występującego w Arizonie owada,
    który żywi się sokami roślin. Natomiast Buchnera aphidicola
    występuje w komórkach niektórych mszyc także żywiących się sokami
    roślin. Taki tryb życia doprowadził je do utraty niektórych funkcji
    i genów pożytecznych w samodzielnego życia. Funkcje te przejęły
    komórki owada produkując niezbędne związki do życia bakterii.
    Natomiast bakterie mogą się odwdzięczać produkując niektóre
    aminokwasy, których w bogatych w cukry sokach roślin jest niewiele.”

  48. KingKong
    Wrzesień 27, 2007 o 10:11 pm

    Wiele czasy zużyłeś, by udowodnić swoje racje, lecz taka durna “pomyłka”… Byłbyś zapewne bardziej wiarygodny gdybyś ukazał swoje racje poprawnie i nieco prostszy sposób
    ———————————————————–
    Mowa trawa,nic mi to nie mówi. Dyskutuj merytorycznie,ponieważ głównym celem forów dyskusyjnych jest to, żeby się czegoś nauczyć,a jak ci czasu brakuje, to może lepiej w ogóle się nie odzywać?

  49. Wrzesień 28, 2007 o 9:17 am

    KingKong,

    rozumiem… Dużo dobrego!
    🙄

  50. KingKong
    Wrzesień 28, 2007 o 3:26 pm

    Rachunek jest prosty: istnieje 100 rodzajów aminokwasów ;połowa L
    połowa P. Do powstania życia potrzebnych jest tylko 20 P.
    PRZEPROWADZMY EKSPERYMENT:

    Wezmy kopiec kulek w kolorach czerwonym i białym, przy czym kulki
    występują w różnych rozmiarach. Wrzućmy je do maszyny losującej i
    poledynczo wylosujmy tylko 20 czerwonych kulek i to o ściśle
    wyznaczonych rozmiarach i kolejności. Powiedzmy,że potrzebujemy 100
    takich kulek. Jakie jest prawdopodobieństwo ich wylosowania?

    1-2-3-4-5-6-7-8-9-10-11-12-13-14-15-16-17-18-19-20-21-22-23-24-25-26-
    27-28-29-20-31-32-33-34-35-36-37-38-39-40-41-42-43-44-45-46-47-48-49-
    50-51-52-53-54-55-56-57-58-59-60-61-62-63-64-65-66-67-68-69-70-71-72-
    73-74-75-76-77-78-79-80-81-82-83-84-85-86-87-88-89-90-91-92-93-94-95-
    96-97-98-99-100

    Oczywiście kulki białe i czerwone to analogie do Lewych i Prawych
    aminokwasów, rozmiary natomiast do ich różnych rodzajów (100).
    Masz jakieś uzasadnione pretensje do tego modelu? A przecież w
    rzeczywistości potrzebne są dłuższe ilości takich kulek w ściśle
    określonej sekwencji (analogia do potrzebnych w rzeczywistości
    dłuższych polipeptydów).
    Potrzeba kilkuset takich ściśle określonych „sznurów koralików” i to
    powstałych o właściwym czasie i miejscu. Można to sobie wyobrazić
    jako równoczesne losowanie kilkuset takich maszyn i za pierwszym
    razem trafienie właściwych wyników!

    A co z kodem genetycznym? Czy to będzie DNA czy RNA, to przy
    założeniu ,że pierwsze postulowane przez ewolucjonistów życie
    posługiwało się dzisiejszym kodem (jeden aminokwas kodowany przez
    trzy nukleotydy-nikt bardziej wiarygodnej opcji nie wymyślił [proszę
    sobie darować alternatywne hipotezy,znane mi są owe prawdy wiary]),
    to przy odwołaniu się do naszego modelu, to taki kod dla jednegojednego ze stukulkowego sznura koralików ,przedstawiający tu polipeptyd, złożony
    musi być ze sznura 300 kuleczek, w którym owe kulki występują w
    czterech różnych kolorach, ułożone we właściwej sekwencji!

    No i znowu możemy puśić w ruch naszą maszyne losującą, a właściwie
    równocześnie kilkaset takich maszyn i to równocześnie z tamtymi
    maszynami losującymi kulki przedstawiające aminokwasy.

    pozdrawiam.

  51. Wrzesień 28, 2007 o 5:52 pm

    KingKong ,

    uczysz nas liczyć do stu? Ja już umiem😳

  52. KingKong
    Wrzesień 28, 2007 o 8:44 pm

    Wiesz ,ja wam zazdroszcze tej wiary:)

  53. Wrzesień 29, 2007 o 3:45 am

    KingKong,

    czyżbyś zamierzał teraz wypisać cyferki od 101 do 200
    😥

  54. KingKong-dodatek do tekstu.
    Październik 2, 2007 o 9:57 am

    A po co, co głupka przekona?

  55. Październik 2, 2007 o 2:15 pm

    KingKong-dodatek do tekstu. ,

    głupka…???

    może od 301 do 400

    spróbujesz?

  1. Sierpień 19, 2007 o 10:05 pm

Skomentuj

Wprowadź swoje dane lub kliknij jedną z tych ikon, aby się zalogować:

Logo WordPress.com

Komentujesz korzystając z konta WordPress.com. Log Out / Zmień )

Zdjęcie z Twittera

Komentujesz korzystając z konta Twitter. Log Out / Zmień )

Facebook photo

Komentujesz korzystając z konta Facebook. Log Out / Zmień )

Google+ photo

Komentujesz korzystając z konta Google+. Log Out / Zmień )

Connecting to %s

%d bloggers like this: